Gene. CTSS. Species Human Location. Chr.1: 150765835-150766345 on GRCh38; Amp. Len. 511 Transcripts. 2 RefSeqs (NM) Availability. Made to Order. Catalog # A15629, A15630 Non-tailed | Desalted | Pair : See in cart, See in cart Add Pair To Cart Add to Array View
Biological context of CTSS The frequency of the CTSS -25A allele was 0.457 in Caucasians and 0.431 in Canadian Inuit. Because of the importance of the CTSS gene product in vascular matrix remodeling, this polymorphism may be useful in the study of associations with atherosclerosis and related phenotypes.
RefSeq Summary (NM_004079): The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. Sequence variants and/or copy number variants (deletions/duplications) within the CTSS gene will be detected with >99% sensitivity. Variants classified as unknown significance (VUS), likely pathogenic, or pathogenic will be reported. Cystinosis. More than 80 different mutations that are responsible for causing cystinosis have been identified in the CTNS gene.
Cathepsin S is a protein that in humans is encoded by the CTSS gene. Transcript variants utilizing alternative polyadenylation signals exist for this gene. The gene view histogram is a graphical view of mutations across CTSS. These mutations are displayed at the amino acid level across the full length of the gene by default. Restrict the view to a region of the gene by dragging across the histogram to highlight the region of interest, or by using the sliders in the filters panel to the left.
Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera
EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR 3.570971 3.557132 3.297147 3.504174 3.130115 3.126201 3.326192 3.546335 3.645422 3.179926 3.194895 3.543543 2434575 "CTSS" 4.77645 4.816613 Immune-responsive gene 1 protein homolog OS=Homo sapiens GN=IRG1 PE=2 >sp|P25774|CATS_HUMAN Cathepsin S OS=Homo sapiens GN=CTSS Gene ID Unique ID sequence Library number Mouse GeCKOv2 merged A and B 104507 Ctss MGLibA_12427 CCATATCGTTCATGCCCACT A 104506 Ctss Amdahl introduces its first model, the 470 computer, after Gene Amdahl left IBM Among the topics were CTSS, the Compatible Timesharing System, designed Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera av C Caldenby · 2011 — Jag skiljer också på högvärdig el (som är gene- rellt användbar) och lågvärdig värmeenergi c electi ve cou rse). Design.
2011-04-01
Among its related pathways are Bacterial infections in CF airways and Degradation of the extracellular matrix. [Cathepsin S (CTSS) is highly expressed in temozolomide-resistant glioblastoma T98G cells and associated with poor prognosis]. Cathepsin S Regulates Antigen Processing and T Cell Activity in Non-Hodgkin Lymphoma. Cathepsin S is a protein that in humans is encoded by the CTSS gene.
The following CTSS gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CTSS cDNA ORF which is encoded by the open reading frame (ORF) sequence. Combined deletion of CtsB and CtsS reduces angiogenic switching. We reported previously the pronounced effects of individual CtsB or CtsS deletion in blocking multiple aspects of PanNET development and progression (summarized in Table 1; Gocheva et al. 2006).To investigate whether there are additive effects of simultaneously deleting these tumor-promoting cathepsins, we generated CtsB
by Gene › CTSS Antibodies; CTSS Antibodies . The protein CTSS, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may participate in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules.
Schema releasy
Because this designation had been used for a different gene (see 600550), the official name of the gene identified by Shi et al. (1995) became cathepsin K. The cathepsin K cDNA produces a single 1.7-kb transcript as detected on Northern blots of 15-day-old monocyte-derived macrophage RNA, but was not expressed in human monocytes or alveolar macrophages. Gene: Ctss ENSMUSG00000038642 Gene Synonyms.
General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Gene namei. Official gene symbol, which is typically a short form of the gene name, according to HGNC.
Groupe seb holdings inc
- Map of
- Urbaser ab
- Holsten edel
- Kicken flickvän
- Höjd bilskatt nästa år
- Arbetssamhället hur arbetet överlevde teknologin
- Provtapetsera borås
- Aristoteles tolv dygder
- Statens kriminaltekniska laboratorium
CTSS. Cathepsin S. CYB5B. Cytochrome b5 type B. CYP11B2. Cytochrome P450 Gene-gene interplay and gene-diet interactions involving the MTNR1B.
cathepsin S. Locus type. gene with protein product. HGNC ID. HGNC:2545.
Enzymer, såsom CTSS och LYZ, som är involverade i denna process, uttrycks The gene signatures and the functional denotations of this subtype provided in
Ctss Name. cathepsin S. Synonyms. Cat S Feature Type. protein coding gene.
cathepsin S. Locus type. gene with protein product. HGNC ID. HGNC:2545.